Part:BBa_K2246007:Experience
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K2246007
Sequencing For the following samples of BSLA devices (Blue chromoprotein, forward siRNA, loop and reverse siRNA): BSLA-AWD, BSLA-SOD, BSLA-WNT and BSLA-RACI the sequencing was made using the VF2 primer, although it was possible to confirm the presence of the blue chromoprotein, the reaction couldn´t show us the presence of the siRNAs constructs because of the length of the protein gene before them. A repetition of the sequencing using the VR primers for the BSLA-SOD and BSLA-RACI devices was performed to seek the siRNA construction before the blue chromoprotein, however the results weren´t conclusive since the alignment showed the correct base pairs just after the reverse primer but not the same sequence before the terminator.
>Sequence obtained with the forward primer (VF2) AGGGATATTCCAGCAATTTTGCCCGTGCCGTCGAAAGGCCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCTACGTAATTAGTTAGTTAGCCCTTAGTGACTCGAATTCGCGGCCGCTTCTAGAGTAATACGACTCACTATAGGGAATACAAGCTACTTGTTCTTTTTGCATACTAGAGAAAGAGGAGAAATACTAGATGAGTGTGATCGCTAAACAAATGACCTACAAGGTTTATATGTCAGGCACGGTCAATGGACACTACTTTGAGGTCGAAGGCGATGGAAAAGGTAAGCCCTACGAGGGGGAGCAGACGGTAAAGCTCACTGTCACCAAGGGCGGACCTCTGCCATTTGCTTGGGATATTTTATCACCACAGTGTCAGTACGGAAGCATACCATTCACCAAGTACCCTGAAGACATCCCTGACTATGTAAAGCAGTCATTCCCGGAGGGCTATACATGGGAGAGGATCATGAACTTTGAAGATGGTGCAGTGTGTACTGTCAGCAATGATTCCAGCATCCAAGCAACTGTTTCATCTACCATGTCAAGTTCTCTGGTTTTGAACTTTCCTCCCAATGGACCTGGTCTTGCAGAAAGAAAGAACAAAGGGCTGGGAACCCCAC
User Reviews
UNIQ7aa68e31c72765af-partinfo-00000000-QINU UNIQ7aa68e31c72765af-partinfo-00000001-QINU